Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-EGFP
(Plasmid #50465)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50465 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 50465-AAV1 Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. $405
AAV1 trial size 50465-AAV1.T Virus (20 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. $140
AAV2 50465-AAV2 Virus (100 µL at titer ≥ 3×10¹² vg/mL) and Plasmid. $405
AAV2 trial size 50465-AAV2.T Limited Stock Available, 1 unit left
Virus (20 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$140
AAV5 50465-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV5 trial size 50465-AAV5.T Virus (20 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $140
AAV8 50465-AAV8 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV8 trial size 50465-AAV8.T Virus (20 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $140
AAV9 50465-AAV9 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV9 trial size 50465-AAV9.T Virus (20 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $140
AAV Retrograde 50465-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV Retrograde trial size 50465-AAVrg.T Virus (20 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $140

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5265
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    726
  • Promoter human Synapsin 1
  • Tag / Fusion Protein
    • N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Information for AAV1 (Catalog # 50465-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV1 trial size (Catalog # 50465-AAV1.T) ( Back to top)

Purpose

Ready-to-use AAV1 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 20 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV2 (Catalog # 50465-AAV2) ( Back to top)

Purpose

Ready-to-use AAV2 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 3×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Data submitted about 50465-AAV2 by requesting scientist(s):

Information for AAV2 trial size (Catalog # 50465-AAV2.T) ( Back to top)

Purpose

Ready-to-use AAV2 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 20 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 50465-AAV5) ( Back to top)

Purpose

Ready-to-use AAV5 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 trial size (Catalog # 50465-AAV5.T) ( Back to top)

Purpose

Ready-to-use AAV5 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 20 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV8 (Catalog # 50465-AAV8) ( Back to top)

Purpose

Ready-to-use AAV8 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV8 trial size (Catalog # 50465-AAV8.T) ( Back to top)

Purpose

Ready-to-use AAV8 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 20 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 50465-AAV9) ( Back to top)

Purpose

Ready-to-use AAV9 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 trial size (Catalog # 50465-AAV9.T) ( Back to top)

Purpose

Ready-to-use AAV9 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 20 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 50465-AAVrg) ( Back to top)

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

Synapsin-driven EGFP-expression control. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Information for AAV Retrograde trial size (Catalog # 50465-AAVrg.T) ( Back to top)

Purpose

Ready-to-use AAV Retrograde trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA.

hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.

Delivery

  • Volume 20 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-EGFP was a gift from Bryan Roth (Addgene plasmid # 50465 ; http://n2t.net/addgene:50465 ; RRID:Addgene_50465) For viral preps, please replace (Addgene plasmid # 50465) in the above sentence with: (Addgene viral prep # 50465-AAV1), (Addgene viral prep # 50465-AAV1.T), (Addgene viral prep # 50465-AAV2), (Addgene viral prep # 50465-AAV2.T), (Addgene viral prep # 50465-AAV5), (Addgene viral prep # 50465-AAV5.T), (Addgene viral prep # 50465-AAV8), (Addgene viral prep # 50465-AAV8.T), (Addgene viral prep # 50465-AAV9), (Addgene viral prep # 50465-AAV9.T), (Addgene viral prep # 50465-AAVrg), or (Addgene viral prep # 50465-AAVrg.T)